Top » Catalog » SNPs » FGC4078

$18.00

FGC4078
[FGC4078]

FGC4078
hg38 Position: ChrY:4314072..4314072
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: .
Forward Primer: FGC4078_F CAGCAAACCAAGATGGCAA
Reverse Primer: FGC4078_R GTCCACTTTTTTTGACACTTAAAATTAC
Reviews

Customers who bought this product also purchased
DF49
DF49
FGC12948
FGC12948
S566
S566
FGC5864
FGC5864
A725
A725
FGC456
FGC456
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies