Top » Catalog » SNPs » A337

$18.00

A337
[A337]

A337
hg38 Position: ChrY:7475462..7475462
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A337_F TTTGCTGTTTTAGTCATGAAGTCTG
Reverse Primer: A337_R CTACTTTAAAGTTCATATGGAACCCG
Reviews

Customers who bought this product also purchased
A341
A341
A206
A206
A351
A351
A214
A214
A293
A293
A346
A346
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies