Top » Catalog » SNPs » A337

$18.00

A337
[A337]

A337
hg38 Position: ChrY:7475462..7475462
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A337_F TTTGCTGTTTTAGTCATGAAGTCTG
Reverse Primer: A337_R CTACTTTAAAGTTCATATGGAACCCG
Reviews

Customers who bought this product also purchased
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
A346
A346
A212
A212
A350
A350
A292
A292
DYS481
DYS481
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies