Top » Catalog » SNPs » A340

$18.00

A340
[A340]

A340
hg38 Position: ChrY:12257083..12257083
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A340_F ACATATTCACATTTATATATTTATGAATATATATGC
Reverse Primer: A340_R GAAGCATGATGATTGTATATACATGTG
Reviews

Customers who bought this product also purchased
A337
A337
A341
A341
A206
A206
A351
A351
A214
A214
A293
A293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies