Top » Catalog » SNPs » A342

$18.00

A342
[A342]

A342
hg38 Position: ChrY:13684884..13684884
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A342_F ATAGTCCCAGCCCCCAAAC
Reverse Primer: A342_R ATACAGGCTCCTTTTTGGTTC
Reviews

Customers who bought this product also purchased
A211
A211
A349
A349
A217
A217
A355
A355
A340
A340
A210
A210
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A640
1 x A1230
1 x A2159
1 x A1499
1 x A238
1 x A1753
1 x A1490
1 x A534
1 x A1064
1 x A494
1 x A588
1 x A772
1 x A739
1 x A1746
1 x A387
1 x A647
1 x A299
1 x A1340
1 x A796
1 x A2199
1 x A736
1 x A1297
1 x A658
1 x A638
1 x A1082
1 x A6
1 x A712
$486.00
Haplogroup Info
Other products
Currencies