Top » Catalog » SNPs » PF7563

$18.00

PF7563
[PF7563]

PF7563
hg38 Position: ChrY:8742205..8742205
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: R1b1a1a2b1
Comments: Below M269 > PF7562
Forward Primer: PF7563_F TGGTGTCGGGAATTAGGATG
Reverse Primer: PF7563_R GTGCCCCTGAAAAGCACTAC
Reviews

Customers who bought this product also purchased
Y36979
Y36979
M267
M267
M479
M479
M96
M96
M184
M184
L879
L879
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies