Top » Catalog » SNPs » PF7563

$18.00

PF7563
[PF7563]

PF7563
hg38 Position: ChrY:8742205..8742205
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: R1b1a1a2b1
Comments: Below M269 > PF7562
Forward Primer: PF7563_F TGGTGTCGGGAATTAGGATG
Reverse Primer: PF7563_R GTGCCCCTGAAAAGCACTAC
Reviews

Customers who bought this product also purchased
V13
V13
Y187625
Y187625
FGC40221
FGC40221
BY14588
BY14588
DF27
DF27
Y227626
Y227626
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies