Top » Catalog » SNPs » PF7563

$18.00

PF7563
[PF7563]

PF7563
hg38 Position: ChrY:8742205..8742205
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: R1b1a1a2b1
Comments: Below M269 > PF7562
Forward Primer: PF7563_F TGGTGTCGGGAATTAGGATG
Reverse Primer: PF7563_R GTGCCCCTGAAAAGCACTAC
Reviews

Customers who bought this product also purchased
R1b-Z2103 Panel
R1b-Z2103 Panel
Y101118
Y101118
Y83965
Y83965
Z2105
Z2105
Z2109
Z2109
Y36979
Y36979
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies