Top » Catalog » SNPs » YFS444718

$18.00

YFS444718
[YFS444718]

YFS444718
hg38 Position: ChrY:8333986..8333986
Ancestral: G
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R1b1a2a1a2c1
Comments: Downstream FGC5496 > Y15071 > FGC7448 > FGC5521
Forward Primer: YFS444718_F CCGGTGTTGAAAGTTTTTGG
Reverse Primer: YFS444718_R TGGGATAATATGTCCTGTTGG
Reviews

Customers who bought this product also purchased
Y9097
Y9097
DF49
DF49
FGC43417
FGC43417
FGC11134
FGC11134
A1298
A1298
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies