Top » Catalog » SNPs » YFS444718

$18.00

YFS444718
[YFS444718]

YFS444718
hg38 Position: ChrY:8333986..8333986
Ancestral: G
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R1b1a2a1a2c1
Comments: Downstream FGC5496 > Y15071 > FGC7448 > FGC5521
Forward Primer: YFS444718_F CCGGTGTTGAAAGTTTTTGG
Reverse Primer: YFS444718_R TGGGATAATATGTCCTGTTGG
Reviews

Customers who bought this product also purchased
DF21
DF21
FGC7448
FGC7448
S1088
S1088
Z253
Z253
FGC5494
FGC5494
R1b-FGC5494 Panel
R1b-FGC5494 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies