Top » Catalog » SNPs » YFS444735

$18.00

YFS444735
[YFS444735]

YFS444735
hg38 Position: ChrY:13083466..13083466
Ancestral: T
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: R1b1a2a1a2c1
Comments: Downstream FGC5496 > Y15071 > FGC7448 > FGC5521
Forward Primer: YFS444735_F GTGTGTACCCAGCACAAAGC
Reverse Primer: YFS444735_R AAGATGCTCAGGGAATGTGG
Reviews

Customers who bought this product also purchased
FGC43417
FGC43417
Z39589
Z39589
A117
A117
PF5191
PF5191
FGC7448
FGC7448
FGC5496
FGC5496
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies