Top » Catalog » SNPs » FGC16741

$18.00

FGC16741
[FGC16741]

FGC16741
hg38 Position: ChrY:16980097..16980097
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222
Forward Primer: FGC16741_F AATGTGTCTATCTCCATTCCCTG
Reverse Primer: FGC16741_R CGTTATTACCATCATCACTGCC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies