Top » Catalog » SNPs » FGC16741

$18.00

FGC16741
[FGC16741]

FGC16741
hg38 Position: ChrY:16980097..16980097
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222
Forward Primer: FGC16741_F AATGTGTCTATCTCCATTCCCTG
Reverse Primer: FGC16741_R CGTTATTACCATCATCACTGCC
Reviews

Customers who bought this product also purchased
FGC23592
FGC23592
A10629
A10629
FGC19831
FGC19831
FGC10147
FGC10147
Y9391
Y9391
S603
S603
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies