Top » Catalog » SNPs » A5913

$18.00

A5913
[A5913]

A5913
hg38 Position: ChrY:6874729..6874729
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream S17250 (Din South)
Forward Primer: A5913_F GTTCAGAAAAGCGCCAAAAG
Reverse Primer: A5913_R AAAGCATGCGTTTAATAGATCAC
Reviews

Customers who bought this product also purchased
FT277419
FT277419
M173
M173
Z2582
Z2582
BY97555
BY97555
BY131900
BY131900
BY171434
BY171434
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies