Top » Catalog » SNPs » A5913

$18.00

A5913
[A5913]

A5913
hg38 Position: ChrY:6874729..6874729
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Downstream S17250 (Din South)
Forward Primer: A5913_F GTTCAGAAAAGCGCCAAAAG
Reverse Primer: A5913_R AAAGCATGCGTTTAATAGATCAC
Reviews

Customers who bought this product also purchased
BY106777
BY106777
A13911
A13911
FT14506
FT14506
BY191770
BY191770
Y84307
Y84307
BY189804
BY189804
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies