Top » Catalog » SNPs » V38

$18.00

V38
[V38]

V38
hg38 Position: ChrY:6950250..6950250
Ancestral: C
Derived: T
Reference: Trombetta 2011
ISOGG Haplogroup: E1b1a
Comments: Approx. hg: E-P2 (x M215). upstream M2
Forward Primer: V38_F GTGTACACAAATACTTATTTCCTAACCG
Reverse Primer: V38_R AGTTCATCTGTCCCTTGGATTAAG
Reviews

Customers who bought this product also purchased
Y77409
Y77409
M145
M145
CTS11248
CTS11248
V1994
V1994
M526
M526
CTS8432
CTS8432
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies