Top » Catalog » SNPs » V38

$18.00

V38
[V38]

V38
hg38 Position: ChrY:6950250..6950250
Ancestral: C
Derived: T
Reference: Trombetta 2011
ISOGG Haplogroup: E1b1a
Comments: Approx. hg: E-P2 (x M215). upstream M2
Forward Primer: V38_F GTGTACACAAATACTTATTTCCTAACCG
Reverse Primer: V38_R AGTTCATCTGTCCCTTGGATTAAG
Reviews

Customers who bought this product also purchased
V12
V12
PF2022
PF2022
CTS4483
CTS4483
E1b-Z834 Panel
E1b-Z834 Panel
Z827
Z827
M81
M81
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies