Top » Catalog » SNPs » V38

$18.00

V38
[V38]

V38
hg38 Position: ChrY:6950250..6950250
Ancestral: C
Derived: T
Reference: Trombetta 2011
ISOGG Haplogroup: E1b1a
Comments: Approx. hg: E-P2 (x M215). upstream M2
Forward Primer: V38_F GTGTACACAAATACTTATTTCCTAACCG
Reverse Primer: V38_R AGTTCATCTGTCCCTTGGATTAAG
Reviews

Customers who bought this product also purchased
Z5009
Z5009
MZ284
MZ284
MZ90
MZ90
PF2546
PF2546
BY8888
BY8888
MZ11
MZ11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies