Top » Catalog » SNPs » A5919

$18.00

A5919
[A5919]

A5919
HG19 Position: ChrY:2871817..2871817
Ancestral: A
Derived: G
Reference: Richard McCutchen (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC10117
Forward Primer: A5919v2_F GTACTCAGGTGTGAGCCAGTG
Reverse Primer: A5919v2_R CTGAGGCAGGAAGCTCACC
Reviews

Customers who bought this product also purchased
Z16500
Z16500
L1065
L1065
DF41
DF41
S1026
S1026
S691
S691
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies