Top » Catalog » SNPs » A5919

$18.00

A5919
[A5919]

A5919
HG19 Position: ChrY:2871817..2871817
Ancestral: A
Derived: G
Reference: Richard McCutchen (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC10117
Forward Primer: A5919v2_F GTACTCAGGTGTGAGCCAGTG
Reverse Primer: A5919v2_R CTGAGGCAGGAAGCTCACC
Reviews

Customers who bought this product also purchased
DF49
DF49
PH367
PH367
L1335
L1335
S744
S744
DF13
DF13
FGC10125
FGC10125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies