Top » Catalog » SNPs » A5919

$18.00

A5919
[A5919]

A5919
HG19 Position: ChrY:2739858..2739858
Ancestral: A
Derived: G
Reference: Richard McCutchen (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC10117
Forward Primer: A5919v2_F GTACTCAGGTGTGAGCCAGTG
Reverse Primer: A5919v2_R CTGAGGCAGGAAGCTCACC
Reviews

Customers who bought this product also purchased
S691
S691
Z39589
Z39589
CTS1751
CTS1751
S764
S764
DF49
DF49
PH367
PH367
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies