Top » Catalog » SNPs » A5919

$18.00

A5919
[A5919]

A5919
HG19 Position: ChrY:2739858..2739858
Ancestral: A
Derived: G
Reference: Richard McCutchen (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC10117
Forward Primer: A5919v2_F GTACTCAGGTGTGAGCCAGTG
Reverse Primer: A5919v2_R CTGAGGCAGGAAGCTCACC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies