Top » Catalog » SNPs » A348

$18.00

A348
[A348]

A348
hg38 Position: ChrY:15388614..15388614
Ancestral: G
Derived: A
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A348_F CTCTATGATTTTCTTGTGGTATTTAGTAGC
Reverse Primer: A348_R CAGATTTATGCCGCTCAAAATAG
Reviews

Customers who bought this product also purchased
A214
A214
A351
A351
A293
A293
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
A344
A344
A212
A212
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies