Top » Catalog » SNPs » A348

$18.00

A348
[A348]

A348
hg38 Position: ChrY:15388614..15388614
Ancestral: G
Derived: A
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A348_F CTCTATGATTTTCTTGTGGTATTTAGTAGC
Reverse Primer: A348_R CAGATTTATGCCGCTCAAAATAG
Reviews

Customers who bought this product also purchased
A210
A210
A347
A347
A218
A218
A354
A354
A338
A338
A208
A208
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies