Top » Catalog » SNPs » A349

$18.00

A349
[A349]

A349
hg38 Position: ChrY:15426125..15426125
Ancestral: C
Derived: T
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A349_F AGAAGTGACCAAGTTGTTGTTAAGAG
Reverse Primer: A349_R CATCAGAAAAGGGTCATATTCCA
Reviews

Customers who bought this product also purchased
A216
A216
A352
A352
A337
A337
A206
A206
A346
A346
A214
A214
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A514
1 x A1185
1 x A30
1 x A1333
1 x A98
1 x A138
$108.00
Haplogroup Info
Other products
Currencies