Top » Catalog » SNPs » A349

$18.00

A349
[A349]

A349
hg38 Position: ChrY:15426125..15426125
Ancestral: C
Derived: T
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A349_F AGAAGTGACCAAGTTGTTGTTAAGAG
Reverse Primer: A349_R CATCAGAAAAGGGTCATATTCCA
Reviews

Customers who bought this product also purchased
A206
A206
A346
A346
A214
A214
A351
A351
A293
A293
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies