Top » Catalog » SNPs » A351

$18.00

A351
[A351]

A351
hg38 Position: ChrY:15849215..15849215
Ancestral: A
Derived: G
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Approx. R1b-CTS4466
Forward Primer: A351_F TTTGAGATGAAATCTCACTGTCATC
Reverse Primer: A351_R TCTTTACCAGGTACCAAGAACCTC
Reviews

Customers who bought this product also purchased
A206
A206
A346
A346
A214
A214
A350
A350
A293
A293
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies