Top » Catalog » SNPs » A351

$18.00

A351
[A351]

A351
hg38 Position: ChrY:15849215..15849215
Ancestral: A
Derived: G
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Approx. R1b-CTS4466
Forward Primer: A351_F TTTGAGATGAAATCTCACTGTCATC
Reverse Primer: A351_R TCTTTACCAGGTACCAAGAACCTC
Reviews

Customers who bought this product also purchased
A337
A337
A206
A206
A346
A346
A214
A214
A350
A350
A293
A293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies