Top » Catalog » SNPs » A354

$18.00

A354
[A354]

A354
hg38 Position: ChrY:19805828..19805828
Ancestral: A
Derived: G
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A354_F CCCATTGTCTCAGCTCCG
Reverse Primer: A354_R TTGAATCTATAAATTATCTTGTGCAGC
Reviews

Customers who bought this product also purchased
A206
A206
A346
A346
A214
A214
A350
A350
A293
A293
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies