Top » Catalog » SNPs » A355

$18.00

A355
[A355]

A355
hg38 Position: ChrY:20899450..20899450
Ancestral: C
Derived: A
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A355_F CAACTCTTGTGCAGACTTAGACAG
Reverse Primer: A355_R AATGGAAGAATTGCAAGGAGAC
Reviews

Customers who bought this product also purchased
A206
A206
A346
A346
A214
A214
A350
A350
A293
A293
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1059
1 x A230
1 x A2234
1 x A431
$72.00
Haplogroup Info
Other products
Currencies