Top » Catalog » SNPs » L51

$18.00

L51
[L51]

L51
hg38 Position: ChrY:8634195..8634195
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1
Comments: Aka M412/PF6536/S167
Forward Primer: L51_F GCTGAACAGGTGCTTCATTG
Reverse Primer: L51_R TAGGCCAATGAGGAACACGA
Reviews

Customers who bought this product also purchased
M96
M96
Y34174
Y34174
Y31385
Y31385
M267
M267
FGC20767
FGC20767
Y63240
Y63240
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies