Top » Catalog » SNPs » L51

$18.00

L51
[L51]

L51
hg38 Position: ChrY:8634195..8634195
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1
Comments: Aka M412/PF6536/S167
Forward Primer: L51_F GCTGAACAGGTGCTTCATTG
Reverse Primer: L51_R TAGGCCAATGAGGAACACGA
Reviews

Customers who bought this product also purchased
S511
S511
Z326
Z326
R1b-L48 Panel
R1b-L48 Panel
S268
S268
Z383
Z383
S170
S170
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies