Top » Catalog » SNPs » L51

$18.00

L51
[L51]

L51
hg38 Position: ChrY:8634195..8634195
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1
Comments: Aka M412/PF6536/S167
Forward Primer: L51_F GCTGAACAGGTGCTTCATTG
Reverse Primer: L51_R TAGGCCAATGAGGAACACGA
Reviews

Customers who bought this product also purchased
S588
S588
A10642
A10642
FGC4077
FGC4077
DF85
DF85
A2501
A2501
S659
S659
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies