Top » Catalog » SNPs » L51

$18.00

L51
[L51]

L51
hg38 Position: ChrY:8634195..8634195
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1
Comments: Aka M412/PF6536/S167
Forward Primer: L51_F GCTGAACAGGTGCTTCATTG
Reverse Primer: L51_R TAGGCCAATGAGGAACACGA
Reviews

Customers who bought this product also purchased
P38
P38
L145
L145
Y31384
Y31384
M96
M96
Y34174
Y34174
Y31385
Y31385
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies