Top » Catalog » SNPs » Y5280

$18.00

Y5280
[Y5280]

Y5280
HG19 Position: ChrY:21354226..21354226
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I2a1b1a (not listed)
Comments: Aka FGC7218. Below M423 > L161.1 > L1498 > FGC7156
Forward Primer: Y5280_F TTGAGATGGAGTCTCACTGTGTG
Reverse Primer: Y5280_R GTTTTGCCATGTTGTCCAGAC
Reviews

Customers who bought this product also purchased
L161.1
L161.1
CTS10228
CTS10228
A544
A544
FGC7174
FGC7174
FGC7126
FGC7126
L161
L161
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies