Top » Catalog » SNPs » Y5280

$18.00

Y5280
[Y5280]

Y5280
HG19 Position: ChrY:21354226..21354226
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I2a1b1a (not listed)
Comments: Aka FGC7218. Below M423 > L161.1 > L1498 > FGC7156
Forward Primer: Y5280_F TTGAGATGGAGTCTCACTGTGTG
Reverse Primer: Y5280_R GTTTTGCCATGTTGTCCAGAC
Reviews

Customers who bought this product also purchased
CTS10228
CTS10228
A544
A544
FGC7174
FGC7174
L161.1
L161.1
L161
L161
I2a-M423 Panel
I2a-M423 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies