Top » Catalog » SNPs » Z138

$18.00

Z138
[Z138]

Z138
hg38 Position: ChrY:13599460..13599460
Ancestral: C
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2b
Comments: downstream of I1. parallel to L22
Forward Primer: Z138_F GGGAAAGGCCTTGAAGTCAC
Reverse Primer: Z138_R CTCACATTAAGGGCATGCTG
Reviews

Customers who bought this product also purchased
P109
P109
Y7397
Y7397
A2365
A2365
I1-L22 (including P109) Panel
I1-L22 (including P109) Panel
Y23688
Y23688
YP1081
YP1081
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies