Top » Catalog » SNPs » Z138

$18.00

Z138
[Z138]

Z138
hg38 Position: ChrY:13599460..13599460
Ancestral: C
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2b
Comments: downstream of I1. parallel to L22
Forward Primer: Z138_F GGGAAAGGCCTTGAAGTCAC
Reverse Primer: Z138_R CTCACATTAAGGGCATGCTG
Reviews

Customers who bought this product also purchased
FGC15560
FGC15560
Y11205
Y11205
S10908
S10908
A14157
A14157
S10066
S10066
S9940
S9940
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies