Top » Catalog » SNPs » Y14240

$18.00

Y14240
[Y14240]

Y14240
hg38 Position: ChrY:7198579..7198579
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: R1b
Comments: Aka FGC35995; below DF13
Forward Primer: Y14240_F GAAGCGGGCACTTTGTTTAG
Reverse Primer: Y14240_R GGCCGACTGAGATCTAGCAC
Reviews

Customers who bought this product also purchased
BY3927
BY3927
R1b-DF27 Panel
R1b-DF27 Panel
DF63
DF63
BY54624
BY54624
A7907
A7907
BY20463
BY20463
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies