Top » Catalog » SNPs » FGC22728

$18.00

FGC22728
[FGC22728]

FGC22728
hg38 Position: ChrY:21036854..21036854
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC22728_F AGATCTTGTGGTAAGGGCTGAC
Reverse Primer: FGC22728_R CAAAGTTTATCAGTCCTCCAAGG
Reviews

Customers who bought this product also purchased
FGC22735
FGC22735
FGC22725
FGC22725
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies