Top » Catalog » SNPs » S4442

$18.00

S4442
[S4442]

S4442
hg38 Position: ChrY:13077992..13077992
Ancestral: A
Derived: T
Reference: Jim Wilson
ISOGG Haplogroup: R1a1a1b1a3a1c
Comments: Aka. CTS3802
Forward Primer: S4442_F CTTGTTGTGGGGTAGGGC
Reverse Primer: S4442_R AAAAAAAATTACTAAAACCAATAAAAAACTTG
Reviews

Customers who bought this product also purchased
YP276
YP276
CTS3390
CTS3390
S5153
S5153
Y153103
Y153103
YP355
YP355
YP704
YP704
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies