Top » Catalog » SNPs » S5153

$18.00

S5153
[S5153]

S5153
hg38 Position: ChrY:21610174..21610174
Ancestral: T
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream S4458
Forward Primer: S5153_F GAGAAATCTTCACTTAGTACCCAAAAC
Reverse Primer: S5153_R AGATGTGAGAATCATTGCAAAGG
Reviews

Customers who bought this product also purchased
CTS4179
CTS4179
YP3950
YP3950
YP276
YP276
CTS3390
CTS3390
YP355
YP355
Y153103
Y153103
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies