Top » Catalog » SNPs » YP386

$18.00

YP386
[YP386]

YP386
hg38 Position: ChrY:12943003..12943003
Ancestral: C
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a1a1b1a3a1b
Comments: .
Forward Primer: YP386_F GCCAGTGCCTATAGGGCTG
Reverse Primer: YP386_R TTTTTTTTGAGATGGAGTCTCACTG
Reviews

Customers who bought this product also purchased
Z91
Z91
Z834
Z834
Y2395
Y2395
M9
M9
Z282
Z282
Y83617
Y83617
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies