Top » Catalog » SNPs » YP618

$18.00

YP618
[YP618]

YP618
hg38 Position: ChrY:6914942..6914942
Ancestral: A
Derived: T
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: Below Z284 > L448 > YP355 > YP609
Forward Primer: YP618_F CACAGGTGGGCTCATTTTTC
Reverse Primer: YP618_R AAGGGAAAGCCCAAGGTATC
Reviews

Customers who bought this product also purchased
L448
L448
YP5598
YP5598
YP4253
YP4253
YP5007
YP5007
YP5928
YP5928
YP4235
YP4235
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies