Top » Catalog » SNPs » YP704

$18.00

YP704
[YP704]

YP704
hg38 Position: ChrY:8672455..8672455
Ancestral: T
Derived: C
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP704v2_F GCCACTCTTCAAGAAAGAAGAGC
Reverse Primer: YP704v2_R AACGTTTCTTGCACGTTGC
Reviews

Customers who bought this product also purchased
BY30614
BY30614
M343
M343
Y129904
Y129904
L335
L335
Z91
Z91
Z834
Z834
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies