Top » Catalog » SNPs » S3477

$18.00

S3477
[S3477]

S3477
hg38 Position: ChrY:9333406..9333406
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: S3477_F ACAAGGGGCAAATAAGAAAAAG
Reverse Primer: S3477_R GAATATTGAAAAAACAAATCTGTGTATGAG
Reviews

Customers who bought this product also purchased
YP1130
YP1130
Z2035
Z2035
M2747
M2747
YP547
YP547
R1a Superclade Panel
R1a Superclade Panel
S2869
S2869
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies