Top » Catalog » SNPs » YP441

$18.00

YP441
[YP441]

YP441
hg38 Position: ChrY:17029457..17029457
Ancestral: A
Derived: C
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP441_F ATCTACCCCACCTACCAGTATACC
Reverse Primer: YP441_R GTCAGGTATACACTTGACCAGAAATG
Reviews

Customers who bought this product also purchased
Y81602
Y81602
BY30530
BY30530
BY62687
BY62687
YP1224
YP1224
YP5190
YP5190
YP6042
YP6042
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies