Top » Catalog » SNPs » YP547

$18.00

YP547
[YP547]

YP547
hg38 Position: ChrY:15230687..15230687
Ancestral: G
Derived: C
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP547v2_F ACTGAGTCCCCAAAATGTATGC
Reverse Primer: YP547v2_R CAGTGTGGAGATTCCTTAAATAACG
Reviews

Customers who bought this product also purchased
S3477
S3477
S2894
S2894
YP1130
YP1130
R1a-L664 Panel
R1a-L664 Panel
Z2035
Z2035
M2747
M2747
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies