Top » Catalog » SNPs » Z1704

$18.00

Z1704
[Z1704]

Z1704
hg38 Position: ChrY:15691357..15691357
Ancestral: C
Derived: T
Reference: http://dna-forums.com (Ray Banks 2011)
ISOGG Haplogroup: E1b1a1a1a1c1a1a3a1
Comments: downstream from P252 > M4669
Forward Primer: Z1704_F GGTCCATTTAGGGGCTTGTC
Reverse Primer: Z1704_R CTCCCCTGCTCACAAAAGTC
Reviews

Customers who bought this product also purchased
CTS9387
CTS9387
M184
M184
Y94997
Y94997
Z1645
Z1645
FGC35964
FGC35964
CTS4625
CTS4625
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies