Top » Catalog » SNPs » ZS5010

$19.00

ZS5010
[ZS5010]

ZS5010
hg38 Position: ChrY:21457106..21457106
Ancestral: A
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: ZS5010_F CCTTCTGCAGAGTGTGGGTTAC
Reverse Primer: ZS5010_R CTGTGGTCCCATGCACTG
Reviews

Customers who bought this product also purchased
FGC43124
FGC43124
Y212448
Y212448
FGC57151
FGC57151
FGC83053
FGC83053
FGC4415
FGC4415
BY68016
BY68016
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies