Top » Catalog » SNPs » ZS5010

$18.00

ZS5010
[ZS5010]

ZS5010
hg38 Position: ChrY:21457106..21457106
Ancestral: A
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: ZS5010_F CCTTCTGCAGAGTGTGGGTTAC
Reverse Primer: ZS5010_R CTGTGGTCCCATGCACTG
Reviews

Customers who bought this product also purchased
M267
M267
FGC87743
FGC87743
DYS464
DYS464
YSEQ-Alpha
YSEQ-Alpha
M35
M35
L608
L608
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies