Top » Catalog » SNPs » ZS5010

$18.00

ZS5010
[ZS5010]

ZS5010
hg38 Position: ChrY:21457106..21457106
Ancestral: A
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: ZS5010_F CCTTCTGCAGAGTGTGGGTTAC
Reverse Primer: ZS5010_R CTGTGGTCCCATGCACTG
Reviews

Customers who bought this product also purchased
FT362659
FT362659
FGC57150
FGC57150
Y20902
Y20902
ZS10633
ZS10633
FGC43127
FGC43127
ZS5004
ZS5004
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies