Top » Catalog » SNPs » ZS5010

$18.00

ZS5010
[ZS5010]

ZS5010
hg38 Position: ChrY:21457106..21457106
Ancestral: A
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC5
Forward Primer: ZS5010_F CCTTCTGCAGAGTGTGGGTTAC
Reverse Primer: ZS5010_R CTGTGGTCCCATGCACTG
Reviews

Customers who bought this product also purchased
BY136
BY136
DNA Sample Kit
DNA Sample Kit
ZS7721
ZS7721
ZS11519
ZS11519
FGC44917
FGC44917
ZS10800
ZS10800
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies