Top » Catalog » SNPs » ZS5010

$18.00

ZS5010
[ZS5010]

ZS5010
hg38 Position: ChrY:21457106..21457106
Ancestral: A
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC5
Forward Primer: ZS5010_F CCTTCTGCAGAGTGTGGGTTAC
Reverse Primer: ZS5010_R CTGTGGTCCCATGCACTG
Reviews

Customers who bought this product also purchased
FGC43128
FGC43128
ZS10488
ZS10488
FGC54413
FGC54413
ZS10287
ZS10287
FGC1696
FGC1696
FGC7
FGC7
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies