Top » Catalog » SNPs » Z28530

$18.00

Z28530
[Z28530]

Z28530
hg38 Position: ChrY:19749775..19749775
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: J2a1a2a1b1a1 (not listed)
Comments: Downstream of SK1363. PF7413. PF7415
Forward Primer: Z28530_F GCTTTTGCCTTTTCAGTATGATG
Reverse Primer: Z28530_R ACTTTTTCTGGGCTATGTAAATGG
Reviews

Customers who bought this product also purchased
J2-M172 Superclade Panel
J2-M172 Superclade Panel
SK1363
SK1363
P126
P126
M267
M267
Z6064
Z6064
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies