Top » Catalog » SNPs » Z16340

$18.00

Z16340
[Z16340]

Z16340
hg38 Position: ChrY:20909899..20909901
Ancestral: ins
Derived: del
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1a
Comments: Downstream of L513
Forward Primer: Z16340_F GTTGAATCCATTCTTGTTGCTG
Reverse Primer: Z16340_R CCCAAAGTCGGTAGTTTTCG
Reviews (1)

Customers who bought this product also purchased
FGC32842
FGC32842
Z17294
Z17294
Z17296
Z17296
Z17815
Z17815
FGC32837
FGC32837
S5668
S5668
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies